About   Help   FAQ
D19Mit17 Primer Detail
Primers
  • Name
    D19Mit17
  • Primer 1 Sequence
    GCCCACCTTTATATAGAAACATGC
  • Primer 2 Sequence
    TAAAACATGAGGCAAGCTTAAGC
  • ID
    MGI:703132
  • Product Size
    140
  • Other IDs
    D19Mit17 (BROAD)
  • Note
    MIT assay: B240
    Additional information: MIT STS Marker Data Files
Genes
D19Mit17 DNA segment, Chr 19, Massachusetts Institute of Technology 17
Polymorphisms
J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70
Endonuclease Gene Allele Fragments Strains
Not Specified D19Mit17 m 109bp MOLF/EiJ
s 151bp 129/Sv
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D19Mit17 a 100bp CAST/EiJ
b 128bp SPRET/EiJ
c 132bp C3H/HeJ
d 138bp A/J, B6.Cg-Lepob/+, BALB/cJ, C57BL/6J, DBA/2J, LP/J
e 140bp AKR/J, NOD/MrkTac, NON/ShiLt
References
J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/17/2024
MGI 6.24
The Jackson Laboratory