About   Help   FAQ
D19Mit16 Primer Detail
Primers
  • Name
    D19Mit16
  • Primer 1 Sequence
    TCTTAGGTAATCTCCCTTAGGGG
  • Primer 2 Sequence
    TGGTAAATGTAAAACTGAAGCATG
  • ID
    MGI:703133
  • Product Size
    133
  • Other IDs
    D19Mit16 (BROAD)
  • Note
    MIT assay: A748
    Additional information: MIT STS Marker Data Files
Genes
D19Mit16 DNA segment, Chr 19, Massachusetts Institute of Technology 16
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D19Mit16 a 116bp A/J
b 118bp C3H/HeJ, DBA/2J, LP/J
c 132bp AKR/J
d 136bp B6.Cg-Lepob/+, BALB/cJ, C57BL/6J, NOD/MrkTac, NON/ShiLt, SPRET/EiJ
e 146bp CAST/EiJ
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D19Mit16 l larger LG/J
s smaller SM/J
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/10/2024
MGI 6.24
The Jackson Laboratory