D5Mit5 Primer Detail MGI Mouse MGI:703140

D5Mit5 Primer Detail

Name

D5Mit5
Primer 1 Sequence

TGAGTGAGGTGTGGTGATAACC
Primer 2 Sequence

TGTGTCTTCCCCTTTCAACC
ID

MGI:703140
Product Size

141
Other IDs

D5Mit5 (BROAD)
Note

MIT assay: A11
Additional information: MIT STS Marker Data Files

D5Mit5

DNA segment, Chr 5, Massachusetts Institute of Technology 5

J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D5Mit5	m	150bp	MOLF/EiJ
Not Specified	D5Mit5	s	170bp	129/Sv

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D5Mit5	a	142bp	DBA/2J
	b	144bp	A/J, AKR/J, B6.Cg-Lep^ob/+, BALB/cJ, C3H/HeJ, C57BL/6J, LP/J, NOD/MrkTac
	c	158bp	NON/ShiLt
	d	161bp	SPRET/EiJ
	e	164bp	CAST/EiJ

J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24