About   Help   FAQ
D5Mit7 Primer Detail
Primers
  • Name
    D5Mit7
  • Primer 1 Sequence
    AAAGGGGGTCTTCTTTGGAA
  • Primer 2 Sequence
    TCTCCTGTAGTGGGTGGTTT
  • ID
    MGI:703142
  • Product Size
    162
  • Other IDs
    D5Mit7 (BROAD)
  • Note
    MIT assay: M154
    Additional information: MIT STS Marker Data Files
Genes
D5Mit7 DNA segment, Chr 5, Massachusetts Institute of Technology 7
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D5Mit7 a 147bp AKR/J, BALB/cJ, C3H/HeJ, CAST/EiJ, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
b 160bp A/J, B6.Cg-Lepob/+, C57BL/6J, SPRET/EiJ
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D5Mit7 l smaller LG/J
s larger SM/J
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D5Mit7 a 160bp A.CA/W, C57BL/6W, C57BL/10W
b 154bp BN/aW
c 147bp 129/SvW, AKR/W, BALB/cW, C3H/W, CBA/W, DBA/2W
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
06/12/2024
MGI 6.13
The Jackson Laboratory