D1Mit218 Primer Detail MGI Mouse MGI:703154

D1Mit218 Primer Detail

Name

D1Mit218
Primer 1 Sequence

TGCAAATGTTACTTTAGTCTCTAGTGG
Primer 2 Sequence

AGTTTTGGTGAGTGATCTTATCCC
ID

MGI:703154
Product Size

145
Other IDs

D1Mit218 (BROAD)
Note

MIT assay: MT1318
Additional information: MIT STS Marker Data Files

D1Mit218

DNA segment, Chr 1, Massachusetts Institute of Technology 218

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D1Mit218	a	117bp	CAST/EiJ
	b	137bp	SPRET/EiJ
	c	147bp	B6.Cg-Lep^ob/+, C57BL/6J, NOD/MrkTac, NON/ShiLt
	d	162bp	A/J, AKR/J, BALB/cJ, C3H/HeJ, DBA/2J, LP/J

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Endonuclease	Gene	Allele	Fragments	Strains
	D1Mit218	a	162bp	A.CA/W, AKR/W, BALB/cW, C3H/W, CBA/W, DBA/2W
	D1Mit218	b	147bp	129/SvW, BN/aW, C57BL/6W, C57BL/10W

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/19/2024 MGI 6.24