D1Mit216 Primer Detail MGI Mouse MGI:703156

D1Mit216 Primer Detail

Name

D1Mit216
Primer 1 Sequence

GGGAGACAACAAATAATCATATTGC
Primer 2 Sequence

AGAGGTGGGTCCTGGAAACT
ID

MGI:703156
Product Size

120
Other IDs

D1Mit216 (BROAD)
Note

MIT assay: MT585
Additional information: MIT STS Marker Data Files

D1Mit216

DNA segment, Chr 1, Massachusetts Institute of Technology 216

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D1Mit216	a	121bp	LP/J, NON/ShiLt
	b	123bp	AKR/J, B6.Cg-Lep^ob/+, C57BL/6J
	c	125bp	A/J, BALB/cJ, C3H/HeJ
	d	129bp	DBA/2J, NOD/MrkTac
	e	135bp	CAST/EiJ

J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87

Gene	Allele	Fragments	Strains
D1Mit216	a	118bp	AKR/OlaHsd, C57BL/6JOlaHsd, C57BL/10
	c	120bp	A/JOlaHsd, BALB/cJ, C3H/HeJ, SJL/J
	d	124bp	DBA/2J
	g	116bp	129P3/J
	j	94bp	JF1
	p	98bp	PWB

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 09/03/2024 MGI 6.24