DXMit95 Primer Detail MGI Mouse MGI:703174

DXMit95 Primer Detail

Name

DXMit95
Primer 1 Sequence

CTGTCAATCTAATTCTCTATGTCTGTG
Primer 2 Sequence

CTTTCCTGGGTGGCAGTG
ID

MGI:703174
Product Size

150
Other IDs

DXMit95 (BROAD)
Note

MIT assay: MT1537
Additional information: MIT STS Marker Data Files

DXMit95a	DNA segment, Chr X, Massachusetts Institute of Technology 95a
DXMit95b	DNA segment, Chr X, Massachusetts Institute of Technology 95b

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
DXMit95a	a	135bp	SPRET/EiJ
	b	137bp	DBA/2J, NOD/MrkTac
	c	141bp	AKR/J
	d	147bp	NON/ShiLt
	e	151bp	A/J, B6.Cg-Lep^ob/+, BALB/cJ, C3H/HeJ, C57BL/6J, LP/J
	f	157bp	CAST/EiJ

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	DXMit95a	c	149bp	CBA/CaOlaHsd
	DXMit95a	s	145bp	SWR/OlaHsd

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Gene	Allele	Fragments	Strains
DXMit95a	a	151bp	129/SvW, A.CA/W, BALB/cW, BN/aW, C3H/W, C57BL/6W, C57BL/10W, CBA/W
	b	145bp	AKR/W
	c	137bp	DBA/2W

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/17/2024 MGI 6.24