D12Mit14 Primer Detail MGI Mouse MGI:703180

D12Mit14 Primer Detail

Name

D12Mit14
Primer 1 Sequence

GAGAGAGTTTCCCTTGTTGTCG
Primer 2 Sequence

AACTCTCTAGGCAGAGTGCCC
ID

MGI:703180
Product Size

127
Note

MIT assay: J15

D12Mit14

DNA segment, Chr 12, Massachusetts Institute of Technology 14

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D12Mit14	b	smaller	C57BL/6J
	D12Mit14	f	larger	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D12Mit14	a	130bp	B6.Cg-Lep^ob/+, C57BL/6J
	b	140bp	CAST/EiJ
	c	146bp	A/J, AKR/J, BALB/cJ, C3H/HeJ, DBA/2J, LP/J, NOD/MrkTac
	d	150bp	SPRET/EiJ

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 06/12/2024 MGI 6.13