About   Help   FAQ
D12Mit10 Primer Detail
Primers
  • Name
    D12Mit10
  • Primer 1 Sequence
    ATCGTGGGAACAAGACCATC
  • Primer 2 Sequence
    AGAATTCATGCTTTGCATTGG
  • ID
    MGI:703184
  • Product Size
    131
  • Other IDs
    D12Mit10 (BROAD)
  • Note
    MIT assay: A673
    Additional information: MIT STS Marker Data Files
Genes
D12Mit10a DNA segment, Chr 12, Massachusetts Institute of Technology 10a
D12Mit10b DNA segment, Chr 12, Massachusetts Institute of Technology 10b
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D12Mit10a b smaller C57BL/6J
f larger FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D12Mit10a a 134bp CAST/EiJ
b 148bp A/J
c 152bp AKR/J
d 154bp B6.Cg-Lepob/+, BALB/cJ, C57BL/6J
e 156bp SPRET/EiJ
f 158bp LP/J, NON/ShiLt
g 160bp C3H/HeJ, NOD/MrkTac
h 164bp DBA/2J
J:55077 Le Voyer TE, et al., Mamm Genome. 1999 Jun;10(6):542-3
Endonuclease Gene Allele Fragments Strains
D12Mit10a c not given C58/J
f not given FVB/NJ
i smaller I/LnJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D11Mit10 c 127bp CBA/CaOlaHsd
s 115bp SWR/OlaHsd
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:55077 Le Voyer TE, et al., Microsatellite DNA variants among the FVB/NJ, C58/J, and I/LnJ mouse strains. Mamm Genome. 1999 Jun;10(6):542-3
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/10/2024
MGI 6.24
The Jackson Laboratory