D12Mit150 Primer Detail MGI Mouse MGI:703187

D12Mit150 Primer Detail

Name

D12Mit150
Primer 1 Sequence

CTTGTCAAAATTTCTGTTGTTTTACA
Primer 2 Sequence

AAAGGATTTTGTCACTAAGACATGG
ID

MGI:703187
Product Size

171
Other IDs

D12Mit150 (BROAD)
Note

MIT assay: MT1609
Additional information: MIT STS Marker Data Files

D12Mit150a	DNA segment, Chr 12, Massachusetts Institute of Technology 150a
D12Mit150b	DNA segment, Chr 12, Massachusetts Institute of Technology 150b

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D12Mit150a	a	107bp	DBA/2J
	b	153bp	BALB/cJ, NON/ShiLt
	c	157bp	CAST/EiJ
	d	171bp	B6.Cg-Lep^ob/+, C3H/HeJ, C57BL/6J, LP/J, NOD/MrkTac
	e	173bp	A/J, AKR/J, SPRET/EiJ

J:90435 Golas A, et al., MGI Direct Data Submission. 2004;

Endonuclease	Gene	Allele	Fragments	Strains
	D12Mit150a	c	larger	CBA/Kw
	D12Mit150a	e	smaller	KE

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24