D12Mit153 Primer Detail MGI Mouse MGI:703190

D12Mit153 Primer Detail

Name

D12Mit153
Primer 1 Sequence

AAATGATTTGGGCAGTCCAG
Primer 2 Sequence

TGAAAAGGCCTTTATGTATTCTCA
ID

MGI:703190
Product Size

142
Other IDs

D12Mit153 (BROAD)
Note

MIT assay: MT2713
Additional information: MIT STS Marker Data Files

DNA segment, Chr 12, Massachusetts Institute of Technology 153

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D12Mit153	a	156bp	129X1/Sv
Not Specified	D12Mit153	f	154, 158bp	CD-1

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D12Mit153	a	134bp	SPRET/EiJ
	b	140bp	CAST/EiJ
	c	142bp	B6.Cg-Lep^ob/+, C57BL/6J
	d	146bp	NON/ShiLt
	e	156bp	A/J, BALB/cJ, C3H/HeJ
	f	158bp	DBA/2J
	g	160bp	LP/J, NOD/MrkTac
	h	164bp	AKR/J

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D12Mit153	c	135bp	CBA/CaOlaHsd
	D12Mit153	s	157bp	SWR/OlaHsd

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/19/2024 MGI 6.24