About   Help   FAQ
D12Mit153 Primer Detail
Primers
  • Name
    D12Mit153
  • Primer 1 Sequence
    AAATGATTTGGGCAGTCCAG
  • Primer 2 Sequence
    TGAAAAGGCCTTTATGTATTCTCA
  • ID
    MGI:703190
  • Product Size
    142
  • Other IDs
    D12Mit153 (BROAD)
  • Note
    MIT assay: MT2713
    Additional information: MIT STS Marker Data Files
Genes
D12Mit153 DNA segment, Chr 12, Massachusetts Institute of Technology 153
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D12Mit153 a 156bp 129X1/Sv
f 154, 158bp CD-1
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D12Mit153 a 134bp SPRET/EiJ
b 140bp CAST/EiJ
c 142bp B6.Cg-Lepob/+, C57BL/6J
d 146bp NON/ShiLt
e 156bp A/J, BALB/cJ, C3H/HeJ
f 158bp DBA/2J
g 160bp LP/J, NOD/MrkTac
h 164bp AKR/J
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D12Mit153 c 135bp CBA/CaOlaHsd
s 157bp SWR/OlaHsd
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/17/2024
MGI 6.24
The Jackson Laboratory