D12Mit19 Primer Detail MGI Mouse MGI:703193

D12Mit19 Primer Detail

Name

D12Mit19
Primer 1 Sequence

GCTTCTTTTTTCTAGAGACCATGA
Primer 2 Sequence

GGAGGTAGAAGGCTGTACATGG
ID

MGI:703193
Product Size

245
Note

MIT assay: D602

D12Mit19

DNA segment, Chr 12, Massachusetts Institute of Technology 19

J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D12Mit19	m	351bp	MOLF/EiJ
Not Specified	D12Mit19	s	343bp	129/Sv

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D12Mit19	a	304bp	DBA/2J
	b	316bp	SPRET/EiJ
	c	318bp	AKR/J
	d	324bp	A/J
	e	334bp	C3H/HeJ, NON/ShiLt
	f	338bp	LP/J, NOD/MrkTac
	g	340bp	BALB/cJ
	h	344bp	B6.Cg-Lep^ob/+
	i	346bp	C57BL/6J
	j	352bp	CAST/EiJ

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D12Mit19	c	133bp	CBA/CaOlaHsd
	D12Mit19	s	128bp	SWR/OlaHsd

J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/12/2024 MGI 6.24