D12Mit157 Primer Detail MGI Mouse MGI:703194

D12Mit157 Primer Detail

Name

D12Mit157
Primer 1 Sequence

TGAGCGTGCGCGTTATAC
Primer 2 Sequence

AGGTTAATATCCTGACCATCACC
ID

MGI:703194
Product Size

159
Note

MIT assay: MT1827

DNA segment, Chr 12, Massachusetts Institute of Technology 157

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D12Mit157	a	136bp	CAST/EiJ
	b	138bp	SPRET/EiJ
	c	148bp	A/J, C3H/HeJ, DBA/2J, NOD/MrkTac, NON/ShiLt
	d	150bp	AKR/J
	e	160bp	B6.Cg-Lep^ob/+, BALB/cJ, C57BL/6J, LP/J

J:156851 Golas A, MGI Direct Data Submission. 2010;

Endonuclease	Gene	Allele	Fragments	Strains
	D12Mit157	b	lower	C57BL/6J
	D12Mit157	s	upper	129/Sv

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

J:156851 Golas A, Microsatellite differences on Chromosome 3, 6, 11 and 12 in C57BL/6J and 129/Sv strains and Mapping in CBXE RI line. MGI Direct Data Submission. 2010;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/12/2024 MGI 6.24