D17Mit33 Primer Detail MGI Mouse MGI:703196

D17Mit33 Primer Detail

Name

D17Mit33
Primer 1 Sequence

TGTTGGAGCTGAATACACGC
Primer 2 Sequence

CCAAACACCAGGGTCTCTGT
ID

MGI:703196
Product Size

199
Other IDs

D17Mit33 (BROAD)
Note

MIT assay: D522
Additional information: MIT STS Marker Data Files

D17Mit33a	DNA segment, Chr 17, Massachusetts Institute of Technology 33a
D17Mit33b	DNA segment, Chr 17, Massachusetts Institute of Technology 33b

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D17Mit33a	a	172bp	AKR/J, C3H/HeJ, NOD/MrkTac, NON/ShiLt
	b	194bp	B6.Cg-Lep^ob/+, C57BL/6J, LP/J, SPRET/EiJ
	c	200bp	A/J, BALB/cJ, CAST/EiJ, DBA/2J

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Gene	Allele	Fragments	Strains
D17Mit33a	a	200bp	BALB/cW, BN/aW, DBA/2W
	b	194bp	129/SvW, C57BL/6W, C57BL/10W
	c	172bp	A.CA/W, AKR/W, C3H/W, CBA/W

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/17/2024 MGI 6.24