D17Mit36 Primer Detail MGI Mouse MGI:703203

D17Mit36 Primer Detail

Name

D17Mit36
Primer 1 Sequence

ATCTCACCAGTCCTTGTTTTCTG
Primer 2 Sequence

CCCCAGAATTTATGTGGTGG
ID

MGI:703203
Product Size

112
Other IDs

D17Mit36 (BROAD)
Note

MIT assay: B203
Additional information: MIT STS Marker Data Files

D17Mit36

DNA segment, Chr 17, Massachusetts Institute of Technology 36

J:42684 Koide T, et al., Mamm Genome. 1998 Jan;9(1):15-9

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D17Mit36	a	largest	MSM/Ms
		b	smaller	JF1
		c	smallest	C57BL/6, DBA/2

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D17Mit36	a	112bp	AKR/J, BALB/cJ, LP/J
	b	114bp	A/J, B6.Cg-Lep^ob/+, C3H/HeJ, C57BL/6J, DBA/2J, NON/ShiLt
	c	146bp	CAST/EiJ, NOD/MrkTac

J:42684 Koide T, et al., A new inbred strain JF1 established from Japanese fancy mouse carrying the classic piebald allele [published erratum appears in Mamm Genome 1998 Apr;9(4):344]. Mamm Genome. 1998 Jan;9(1):15-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24