D4Mit306 Primer Detail MGI Mouse MGI:703204

D4Mit306 Primer Detail

Name

D4Mit306
Primer 1 Sequence

CCACTATTGCTGCCACCAC
Primer 2 Sequence

TAAAAACAGGACATCGCTAATAAGG
ID

MGI:703204
Product Size

120
Other IDs

D4Mit306 (BROAD)
Note

MIT assay: MTH2027
Additional information: MIT STS Marker Data Files

D4Mit306

DNA Segment, Chr 4, Massachusetts Institute of Technology 306

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D4Mit306	a	114bp	AKR/J, NON/ShiLt
	b	118bp	CAST/EiJ, SPRET/EiJ
	c	122bp	A/J, B6.Cg-Lep^ob/+, C57BL/6J, DBA/2J, LP/J, NOD/MrkTac
	d	128bp	BALB/cJ

J:90435 Golas A, et al., MGI Direct Data Submission. 2004;

Endonuclease	Gene	Allele	Fragments	Strains
	D4Mit306	c	smaller	CBA/Kw
	D4Mit306	e	larger	KE

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24