D17Mit68 Primer Detail MGI Mouse MGI:703206

D17Mit68 Primer Detail

Name

D17Mit68
Primer 1 Sequence

GTCCTGACATCATGCTTTGTG
Primer 2 Sequence

CTACCGTTTGGAAGGCTGAG
ID

MGI:703206
Product Size

130
Other IDs

D17Mit68 (BROAD)
Note

MIT assay: MPC186
Additional information: MIT STS Marker Data Files

D17Mit68

DNA segment, Chr 17, Massachusetts Institute of Technology 68

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D17Mit68	a	134bp	B6.Cg-Lep^ob/+, C57BL/6J
	b	138bp	LP/J
	c	140bp	A/J, C3H/HeJ, DBA/2J, NON/ShiLt
	d	146bp	AKR/J, BALB/cJ
	e	150bp	SPRET/EiJ
	f	155bp	CAST/EiJ
	g	172bp	NOD/MrkTac

J:90435 Golas A, et al., MGI Direct Data Submission. 2004;

Endonuclease	Gene	Allele	Fragments	Strains
	D17Mit68	c	smaller	CBA/Kw
	D17Mit68	e	larger	KE

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/17/2024 MGI 6.24