D17Mit66 Primer Detail MGI Mouse MGI:703211

D17Mit66 Primer Detail

Name

D17Mit66
Primer 1 Sequence

GGCTTCCACACATGATTGC
Primer 2 Sequence

TTCTGGGTCCATCATCACAA
ID

MGI:703211
Product Size

131
Other IDs

D17Mit66 (BROAD)
Note

MIT assay: MPC858
Additional information: MIT STS Marker Data Files

D17Mit66

DNA segment, Chr 17, Massachusetts Institute of Technology 66

J:39615 Panoutsakopoulou V, et al., Mamm Genome. 1997 May;8(5):357-61

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D17Mit66	b	0.132kb	B10.BR-H2^k, C57BL/6
Not Specified	D17Mit66	c	0.108kb	B10.D2-H2^d, BALB.K-H2^k, BALB/cAnNCr, BALB/cByJ, BALB/cJ

J:46489 You Y, et al., Mamm Genome. 1998 Mar;9(3):232-4

Notes: Data for C57BL/6J and BALB/cJ strains was derived from the Whitehead Institute/MIT genome center website.

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D17Mit66	b	132bp	C57BL/6J
		c	108bp	BALB/cJ
		s	125bp	129X1/SvJ

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D17Mit66	a	108bp	A/J, AKR/J, BALB/cJ, C3H/HeJ, DBA/2J
	b	112bp	CAST/EiJ
	c	124bp	NON/ShiLt
	d	132bp	B6.Cg-Lep^ob/+, C57BL/6J
	e	138bp	NOD/MrkTac

J:39615 Panoutsakopoulou V, et al., Microsatellite typing of CXB recombinant inbred and parental mouse strains. Mamm Genome. 1997 May;8(5):357-61

J:46489 You Y, et al., Utility of C57BL/6J x 129/SvJae embryonic stem cells for generating chromosomal deletions: tolerance to gamma radiation and microsatellite polymorphism. Mamm Genome. 1998 Mar;9(3):232-4

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24