D17Mit62 Primer Detail MGI Mouse MGI:703215

D17Mit62 Primer Detail

Name

D17Mit62
Primer 1 Sequence

CCACATCTTCTAATCCTGCTCA
Primer 2 Sequence

CATATAGCCTGAGACATTCTGCC
ID

MGI:703215
Product Size

172
Other IDs

D17Mit62 (BROAD)
Note

MIT assay: MPC1728
Additional information: MIT STS Marker Data Files

D17Mit62

DNA segment, Chr 17, Massachusetts Institute of Technology 62

J:23589 Vernet C, et al., Mamm Genome. 1995 Mar;6(3):219-21

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D17Mit62	a	smallest	STOCK t¹²
		b	larger	STOCK t^w5
		c	large	C3H, STOCK t^w12

J:44833 Meagher S, et al., Hereditas. 1997;127(1-2):75-82

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D17Mit62	a	smallest	DBA/2J
		b	larger	P/J
		c	larger than above	M. spretus
		d	larger than above	A.CA-H2^f/Sn, CBA/J
		e	larger than above	RIIIS/J
		f	larger than above	SJL/J, SM/J
		g	larger than above	C57BL/6J
		h	larger than above	SWR/J
		i	larger than above	M. caroli
		j	larger than above	CAST/EiJ

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D17Mit62	a	158bp	BALB/cJ, DBA/2J
	b	162bp	SPRET/EiJ
	c	166bp	A/J, AKR/J, C3H/HeJ
	d	174bp	B6.Cg-Lep^ob/+, C57BL/6J, LP/J, NON/ShiLt
	e	176bp	NOD/MrkTac

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Gene	Allele	Fragments	Strains
D17Mit62	a	174bp	129/SvW, C57BL/6W, C57BL/10W
	b	166bp	AKR/W, BN/aW
	c	158bp	A.CA/W, BALB/cW, C3H/W, CBA/W, DBA/2W

J:23589 Vernet C, et al., Mapping of 12 markers in the proximal region of mouse chromosome 17 using recombinant t haplotypes. Mamm Genome. 1995 Mar;6(3):219-21

J:44833 Meagher S, et al., A microsatellite-based MHC genotyping system for house mice (Mus domesticus). Hereditas. 1997;127(1-2):75-82

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/12/2024 MGI 6.24