D11Mit236 Primer Detail MGI Mouse MGI:703220

D11Mit236 Primer Detail

Name

D11Mit236
Primer 1 Sequence

TGCCACTTCTTTAATACATGCG
Primer 2 Sequence

AATTTCCTTCTACTCCTCTCTGAGC
ID

MGI:703220
Product Size

104
Other IDs

D11Mit236 (BROAD)
Note

MIT assay: MT4022
Additional information: MIT STS Marker Data Files

DNA segment, Chr 11, Massachusetts Institute of Technology 236

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D11Mit236	a	118bp	129X1/Sv
Not Specified	D11Mit236	f	84bp	CD-1

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D11Mit236	a	84bp	AKR/J, DBA/2J, NOD/MrkTac
	b	90bp	NON/ShiLt
	c	92bp	CAST/EiJ
	d	106bp	B6.Cg-Lep^ob/+, C57BL/6J
	e	108bp	A/J, C3H/HeJ, SPRET/EiJ
	f	112bp	LP/J
	g	118bp	BALB/cJ

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D11Mit236	c	149bp	CBA/CaOlaHsd
	D11Mit236	s	129bp	SWR/OlaHsd

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 06/12/2024 MGI 6.13