About   Help   FAQ
D11Mit230 Primer Detail
Primers
  • Name
    D11Mit230
  • Primer 1 Sequence
    ACAAAATGTCATCTGAAATGCG
  • Primer 2 Sequence
    TTGTCAGGGAAGGTGAGACC
  • ID
    MGI:703226
  • Product Size
    233
  • Other IDs
    D11Mit230 (BROAD)
  • Note
    MIT assay: MT3863
    Additional information: MIT STS Marker Data Files
Genes
D11Mit230 DNA segment, Chr 11, Massachusetts Institute of Technology 230
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D11Mit230 a 184bp CAST/EiJ
b 210bp A/J
c 214bp C3H/HeJ, DBA/2J
d 224bp B6.Cg-Lepob/+, C57BL/6J, NON/ShiLt
e 254bp AKR/J, BALB/cJ, LP/J, NOD/MrkTac
f 292bp SPRET/EiJ
J:104037 Grzmil P, et al., MGI Direct Data Submission. 2006;
Endonuclease Gene Allele Fragments Strains
D11Mit230 c upper CBA/Kw
k lower KE
J:156851 Golas A, MGI Direct Data Submission. 2010;
Endonuclease Gene Allele Fragments Strains
D11Mit230 b upper C57BL/6J
s lower 129/Sv
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:104037 Grzmil P, et al., Mapping of mouse Chromosome 2, 11 STS markers in CBXE and EXCB RI strains. MGI Direct Data Submission. 2006;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;
J:156851 Golas A, Microsatellite differences on Chromosome 3, 6, 11 and 12 in C57BL/6J and 129/Sv strains and Mapping in CBXE RI line. MGI Direct Data Submission. 2010;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/17/2024
MGI 6.24
The Jackson Laboratory