D3Mit318 Primer Detail MGI Mouse MGI:703231

D3Mit318 Primer Detail

Name

D3Mit318
Primer 1 Sequence

CTCATTCCTTCTGAGCAATGG
Primer 2 Sequence

TATGGGATATGCTTTTCATAAAAGG
ID

MGI:703231
Product Size

148
Other IDs

D3Mit318 (BROAD)
Note

MIT assay: MTH919
Additional information: MIT STS Marker Data Files

D3Mit318

DNA Segment, Chr 3, Massachusetts Institute of Technology 318

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D3Mit318	a	146bp	AKR/J, B6.Cg-Lep^ob/+, C57BL/6J, DBA/2J, NOD/MrkTac, NON/ShiLt
	b	156bp	LP/J
	c	162bp	A/J, BALB/cJ, C3H/HeJ
	d	202bp	SPRET/EiJ

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Endonuclease	Gene	Allele	Fragments	Strains
	D3Mit318	a	162bp	129/SvW, A.CA/W, BALB/cW, BN/aW, C3H/W, CBA/W
	D3Mit318	b	146bp	AKR/W, C57BL/6W, C57BL/10W, DBA/2W

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24