D1Mit18 Primer Detail MGI Mouse MGI:703274

D1Mit18 Primer Detail

Name

D1Mit18
Primer 1 Sequence

TCTGGTTCCAGGCTTGATTC
Primer 2 Sequence

TCACAAGTGAGGCTCCAGG
ID

MGI:703274
Product Size

156
Other IDs

D1Mit18 (BROAD)
Note

MIT assay: A77
Additional information: MIT STS Marker Data Files

D1Mit18

DNA segment, Chr 1, Massachusetts Institute of Technology 18

J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D1Mit18	m	160bp	MOLF/EiJ
Not Specified	D1Mit18	s	205bp	129/Sv

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D1Mit18	a	160bp	A/J, B6.Cg-Lep^ob/+, C3H/HeJ, C57BL/6J, DBA/2J, NON/ShiLt
	b	170bp	AKR/J, BALB/cJ, NOD/MrkTac, SPRET/EiJ
	c	180bp	CAST/EiJ
	d	205bp	LP/J

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Endonuclease	Gene	Allele	Fragments	Strains
	D1Mit18	a	170bp	AKR/W, BALB/cW
	D1Mit18	b	160bp	129/SvW, A.CA/W, BN/aW, C3H/W, C57BL/6W, C57BL/10W, CBA/W, DBA/2W

J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/19/2024 MGI 6.24