D3Mit86 Primer Detail MGI Mouse MGI:703328

D3Mit86 Primer Detail

Name

D3Mit86
Primer 1 Sequence

TGCTCAACATAAAATGTCTGGC
Primer 2 Sequence

AAGCACAGAAACATCTCTCACG
ID

MGI:703328
Product Size

153
Other IDs

D3Mit86 (BROAD)
Note

MIT assay: MPC1122
Additional information: MIT STS Marker Data Files

D3Mit86

DNA segment, Chr 3, Massachusetts Institute of Technology 86

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D3Mit86	a	146bp	DBA/2J, NOD/MrkTac
	b	154bp	B6.Cg-Lep^ob/+, C57BL/6J
	c	162bp	A/J, BALB/cJ, C3H/HeJ, LP/J
	d	166bp	AKR/J, SPRET/EiJ
	e	170bp	CAST/EiJ

J:121994 Grzmil P, et al., MGI Direct Data Submission. 2007;

Endonuclease	Gene	Allele	Fragments	Strains
	D3Mit86	c	lower	CBA/Kw
	D3Mit86	e	upper	KE

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

J:121994 Grzmil P, et al., STS markers on chromosome 1, 3, 5, 8 and 9 in CBXE and EXCB recombinant inbred strains of mice. MGI Direct Data Submission. 2007;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24