D15Mit270 Primer Detail MGI Mouse MGI:703335

D15Mit270 Primer Detail

Name

D15Mit270
Primer 1 Sequence

ATGAGGCTCAATAAGATAAGATGTG
Primer 2 Sequence

GTTGCTACTGTAAATGTCTCCTGTG
ID

MGI:703335
Product Size

200
Other IDs

D15Mit270 (BROAD)
Note

MIT assay: MTH2957
Additional information: MIT STS Marker Data Files

DNA Segment, Chr 15, Massachusetts Institute of Technology 270

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D15Mit270	a	164bp	SPRET/EiJ
	b	178bp	AKR/J
	c	180bp	BALB/cJ, C3H/HeJ, CAST/EiJ
	d	188bp	A/J, DBA/2J
	e	200bp	B6.Cg-Lep^ob/+, C57BL/6J, LP/J, NOD/MrkTac, NON/ShiLt

J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87

Gene	Allele	Fragments	Strains
D15Mit270	a	190bp	A/JOlaHsd, AKR/OlaHsd
	c	180bp	BALB/cJ, C3H/HeJ
	d	192bp	DBA/2J
	j	176bp	JF1
	p	200bp	129P3/J, C57BL/6JOlaHsd, C57BL/10, PWB, SJL/J

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24