D17Mit152 Primer Detail MGI Mouse MGI:703338

D17Mit152 Primer Detail

Name

D17Mit152
Primer 1 Sequence

CCAGTATTCTAGCTGCCCGA
Primer 2 Sequence

GATAAAAATGAGATCAAGATGGGG
ID

MGI:703338
Product Size

126
Other IDs

D17Mit152 (BROAD)
Note

MIT assay: MTH267
Additional information: MIT STS Marker Data Files

DNA segment, Chr 17, Massachusetts Institute of Technology 152

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D17Mit152	a	96bp	BALB/cJ, DBA/2J, NOD/MrkTac, NON/ShiLt
	b	130bp	SPRET/EiJ
	c	132bp	A/J, AKR/J, C3H/HeJ, C57BL/6J, LP/J
	d	134bp	B6.Cg-Lep^ob/+
	e	220bp	CAST/EiJ

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D17Mit152	c	128bp	CBA/CaOlaHsd
	D17Mit152	s	92bp	SWR/OlaHsd

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Endonuclease	Gene	Allele	Fragments	Strains
	D17Mit152	a	132bp	129/SvW, A.CA/W, AKR/W, C3H/W, C57BL/6W, C57BL/10W, CBA/W
	D17Mit152	b	96bp	BALB/cW, BN/aW, DBA/2W

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24