About   Help   FAQ
D19Mit32 Primer Detail
Primers
  • Name
    D19Mit32
  • Primer 1 Sequence
    GGTGCACATGTGTACATGCA
  • Primer 2 Sequence
    TGCAGAACCTGCTGTATGTTG
  • ID
    MGI:703365
  • Product Size
    153
  • Other IDs
    D19Mit32 (BROAD)
  • Note
    MIT assay: B702
    Additional information: MIT STS Marker Data Files
Genes
D19Mit32 DNA segment, Chr 19, Massachusetts Institute of Technology 32
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D19Mit32 a 150bp 129X1/Sv
f 152bp CD-1
J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70
Endonuclease Gene Allele Fragments Strains
Not Specified D19Mit32 m 153bp MOLF/EiJ
s 175bp 129/Sv
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D19Mit32 a 144bp CAST/EiJ
b 150bp A/J, AKR/J, C3H/HeJ, NOD/MrkTac
c 152bp B6.Cg-Lepob/+, BALB/cJ, C57BL/6J, DBA/2J, LP/J
d 158bp NON/ShiLt
e 182bp SPRET/EiJ
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D19Mit32 l larger LG/J
s smaller SM/J
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D19Mit32 c 134bp CBA/CaOlaHsd
s 133bp SWR/OlaHsd
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/17/2024
MGI 6.24
The Jackson Laboratory