D14Mit225 Primer Detail MGI Mouse MGI:703374

D14Mit225 Primer Detail

Name

D14Mit225
Primer 1 Sequence

GATATATCAAGGCTTCCTAAACACA
Primer 2 Sequence

TCAGCATGCAGTTTAAAGTAGATG
ID

MGI:703374
Product Size

121
Other IDs

D14Mit225 (BROAD)
Note

MIT assay: MTH629
Additional information: MIT STS Marker Data Files

DNA segment, Chr 14, Massachusetts Institute of Technology 225

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D14Mit225	a	89bp	SPRET/EiJ
	b	103bp	NOD/MrkTac, NON/ShiLt
	c	105bp	AKR/J, C3H/HeJ, DBA/2J
	d	111bp	LP/J
	e	115bp	CAST/EiJ
	f	121bp	A/J, B6.Cg-Lep^ob/+, BALB/cJ, C57BL/6J

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Gene	Allele	Fragments	Strains
D14Mit225	a	121bp	A.CA/W, BALB/cW, BN/aW, C57BL/6W, C57BL/10W
	b	117bp	129/SvW
	c	105bp	AKR/W, C3H/W, CBA/W, DBA/2W

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/19/2024 MGI 6.24