About   Help   FAQ
D2Mit148 Primer Detail
Primers
  • Name
    D2Mit148
  • Primer 1 Sequence
    GTTCTCTGATCTACGGGCATG
  • Primer 2 Sequence
    TTCACTTCTACAAGTTCTACAAGTTCC
  • ID
    MGI:703380
  • Product Size
    115
  • Other IDs
    D2Mit148 (BROAD)
  • Note
    MIT assay: MMH245
    Additional information: MIT STS Marker Data Files
Genes
D2Mit148 DNA segment, Chr 2, Massachusetts Institute of Technology 148
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D2Mit148 a 131 129X1/Sv
f 121, 131bp CD-1
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D2Mit148 a 117bp B6.Cg-Lepob/+, C57BL/6J
b 121bp C3H/HeJ, DBA/2J, NOD/MrkTac
c 131bp BALB/cJ, LP/J
d 133bp A/J
e 135bp AKR/J
f 149bp NON/ShiLt
g 217bp CAST/EiJ
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
D2Mit148 a 132bp A/JOlaHsd, AKR/OlaHsd, SJL/J
b 116bp C57BL/6JOlaHsd, C57BL/10
c 130bp 129P3/J, BALB/cJ
d 120bp C3H/HeJ, DBA/2J
j 142bp JF1
p 144bp PWB
J:104037 Grzmil P, et al., MGI Direct Data Submission. 2006;
Endonuclease Gene Allele Fragments Strains
D2Mit148 c upper CBA/Kw
k lower KE
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:104037 Grzmil P, et al., Mapping of mouse Chromosome 2, 11 STS markers in CBXE and EXCB RI strains. MGI Direct Data Submission. 2006;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;
Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support. 		last database update
08/02/2024
MGI 6.24 		The Jackson Laboratory