D10Mit61 Primer Detail MGI Mouse MGI:703416

D10Mit61 Primer Detail

Name

D10Mit61
Primer 1 Sequence

GTCATCTCAGGGCACAACCT
Primer 2 Sequence

ACACTCGTGCACACGCAT
ID

MGI:703416
Product Size

145
Other IDs

D10Mit61 (BROAD)
Note

MIT assay: MPC1314
Additional information: MIT STS Marker Data Files

D10Mit61

DNA segment, Chr 10, Massachusetts Institute of Technology 61

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D10Mit61	a	114bp	LP/J
	b	140bp	CAST/EiJ, DBA/2J
	c	148bp	A/J, AKR/J, B6.Cg-Lep^ob/+, BALB/cJ, C3H/HeJ, C57BL/6J, NOD/MrkTac, NON/ShiLt

J:71432 Schwarz M, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D10Mit61	a	larger	129P3/J
	D10Mit61	s	smaller	SJL/J

J:90435 Golas A, et al., MGI Direct Data Submission. 2004;

Endonuclease	Gene	Allele	Fragments	Strains
	D10Mit61	c	upper	CBA/Kw
	D10Mit61	e	lower	KE

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:71432 Schwarz M, Polymorphisms between 129P3/J and SJL/J. MGI Direct Data Submission. 2001;

J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24