D3Mit3 Primer Detail MGI Mouse MGI:703419

D3Mit3 Primer Detail

Name

D3Mit3
Primer 1 Sequence

CCTTTTGAGGCAAAGCTCC
Primer 2 Sequence

CTAAGTCCTGCACCTGCCTC
ID

MGI:703419
Product Size

102
Other IDs

D3Mit3 (BROAD)
Note

MIT assay: M250
Additional information: MIT STS Marker Data Files

D3Mit3

DNA segment, Chr 3, Massachusetts Institute of Technology 3

J:42684 Koide T, et al., Mamm Genome. 1998 Jan;9(1):15-9

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D3Mit3	a	largest	JF1, MSM/Ms
Not Specified	D3Mit3	b	smaller	C57BL/6, DBA/2

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D3Mit3	a	88bp	SPRET/EiJ
	b	104bp	C3H/HeJ, NON/ShiLt
	c	108bp	AKR/J, B6.Cg-Lep^ob/+, C57BL/6J, DBA/2J, NOD/MrkTac
	d	109bp	A/J, BALB/cJ, LP/J
	e	200bp	CAST/EiJ

J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12

Endonuclease	Gene	Allele	Fragments	Strains
	D3Mit3	l	smaller	LG/J
	D3Mit3	s	larger	SM/J

J:42684 Koide T, et al., A new inbred strain JF1 established from Japanese fancy mouse carrying the classic piebald allele [published erratum appears in Mamm Genome 1998 Apr;9(4):344]. Mamm Genome. 1998 Jan;9(1):15-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24