D10Mit64 Primer Detail MGI Mouse MGI:703421

D10Mit64 Primer Detail

Name

D10Mit64
Primer 1 Sequence

TTCCCATTTGGCTATTTCTCC
Primer 2 Sequence

ACACCGTATCATGTGGTCTCTG
ID

MGI:703421
Product Size

166
Other IDs

D10Mit64 (BROAD)
Note

MIT assay: MPC226
Additional information: MIT STS Marker Data Files

D10Mit64

DNA segment, Chr 10, Massachusetts Institute of Technology 64

J:45743 Zobeley E, et al., Genomics. 1998 Jun 1;50(2):260-6

Notes: The CASA/Rk allele was 2bp larger than the av allele in SSLP analysis.

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D10Mit64	b	smaller	B6.BKS-Pcdh15^av-J
Not Specified	D10Mit64	c	larger	CASA/RkJ

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D10Mit64	a	160bp	NOD/MrkTac
	b	166bp	A/J, B6.Cg-Lep^ob/+, BALB/cJ, C3H/HeJ, C57BL/6J, DBA/2J, LP/J, NON/ShiLt
	c	168bp	AKR/J, CAST/EiJ
	d	170bp	SPRET/EiJ

J:45743 Zobeley E, et al., Fine genetic and comparative mapping of the deafness mutation Ames waltzer on mouse chromosome 10. Genomics. 1998 Jun 1;50(2):260-6

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24