D2Mit61 Primer Detail MGI Mouse MGI:703462

D2Mit61 Primer Detail

Name

D2Mit61
Primer 1 Sequence

AAAGTCAACTGCTTTCAGTTACCC
Primer 2 Sequence

CACAGAAGTGCCCTTGCATA
ID

MGI:703462
Product Size

147
Other IDs

D2Mit61 (BROAD)
Note

MIT assay: D587
Additional information: MIT STS Marker Data Files

D2Mit61

DNA segment, Chr 2, Massachusetts Institute of Technology 61

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D2Mit61	b	larger	C57BL/6J
	D2Mit61	f	smaller	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D2Mit61	a	122bp	SPRET/EiJ
	b	128bp	LP/J
	c	142bp	C3H/HeJ
	d	144bp	A/J, B6.Cg-Lep^ob/+, BALB/cJ, C57BL/6J, NOD/MrkTac
	e	146bp	AKR/J
	f	156bp	DBA/2J
	g	158bp	CAST/EiJ

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24