About   Help   FAQ
D8Mit112 Primer Detail
Primers
  • Name
    D8Mit112
  • Primer 1 Sequence
    ATATCAGGCATGCATTATGATCC
  • Primer 2 Sequence
    TCTCTCTAGTGGGATTATCAACACA
  • ID
    MGI:703501
  • Product Size
    120
  • Other IDs
    D8Mit112 (BROAD)
  • Note
    MIT assay: MPC2374
    Additional information: MIT STS Marker Data Files
Genes
D9Mit1001 DNA segment, Chr 9, Massachusetts Institute of Technology 1001
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D9Mit1001 a 124bp 129X1/Sv
f 100, 124bp CD-1
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D9Mit1001 a 100bp SPRET/EiJ
b 122bp B6.Cg-Lepob/+, C57BL/6J
c 124bp AKR/J, DBA/2J, NON/ShiLt
d 128bp A/J, BALB/cJ, LP/J, NOD/MrkTac
e 132bp C3H/HeJ
f 134bp CAST/EiJ
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
D9Mit1001 b 118bp C57BL/6JOlaHsd, C57BL/10
c 124bp BALB/cJ, C3H/HeJ
d 120bp A/JOlaHsd, AKR/OlaHsd, DBA/2J
j 126bp 129P3/J, JF1
l 112bp SJL/J
p 132bp PWB
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D9Mit1001 c 119bp CBA/CaOlaHsd
s 125bp SWR/OlaHsd
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;
Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support. 		last database update
12/10/2024
MGI 6.24 		The Jackson Laboratory