D16Mit57 Primer Detail MGI Mouse MGI:703509

D16Mit57 Primer Detail

Name

D16Mit57
Primer 1 Sequence

AAAAAATTTTAAACCATGTGAATGT
Primer 2 Sequence

TGAAGTTTATTATGAGTTGAATCATGC
ID

MGI:703509
Product Size

112
Other IDs

D16Mit57 (BROAD)
Note

MIT assay: MPC716
Additional information: MIT STS Marker Data Files

D16Mit57

DNA segment, Chr 16, Massachusetts Institute of Technology 57

J:50545 Augustin M, et al., Mamm Genome. 1998 Nov;9(11):899-902

Endonuclease	Gene	Allele	Fragments	Strains
	D16Mit57	b	0.111kb	C57BL/6J
	D16Mit57	s	0.135kb	SEG/1

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D16Mit57	a	93bp	A/J, BALB/cJ
	b	95bp	AKR/J
	c	107bp	NOD/MrkTac, NON/ShiLt
	d	111bp	C3H/HeJ, C57BL/6J, DBA/2J
	e	113bp	B6.Cg-Lep^ob/+, LP/J
	f	133bp	CAST/EiJ
	g	135bp	SPRET/EiJ

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D16Mit57	c	147bp	CBA/CaOlaHsd
	D16Mit57	s	130bp	SWR/OlaHsd

J:50545 Augustin M, et al., Cloning and chromosomal mapping of the human p53-related KET gene to chromosome 3q27 and its murine homolog Ket to mouse chromosome 16. Mamm Genome. 1998 Nov;9(11):899-902

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24