D16Mit55 Primer Detail MGI Mouse MGI:703511

D16Mit55 Primer Detail

Name

D16Mit55
Primer 1 Sequence

TATGCGTTTAGTAATGATTTCCTACG
Primer 2 Sequence

TGTAAGGACATATCTACCTTATCACCC
ID

MGI:703511
Product Size

135
Note

MIT assay: MPC2196

D16Mit55

DNA segment, Chr 16, Massachusetts Institute of Technology 55

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D16Mit55	a	87bp	SPRET/EiJ
	b	113bp	B6.Cg-Lep^ob/+, C57BL/6J
	c	117bp	C3H/HeJ, CAST/EiJ, DBA/2J, NON/ShiLt
	d	119bp	BALB/cJ
	e	121bp	A/J
	f	143bp	AKR/J, NOD/MrkTac
	g	145bp	LP/J

J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87

Gene	Allele	Fragments	Strains
D16Mit55	d	104bp	A/JOlaHsd, AKR/OlaHsd, BALB/cJ, C3H/HeJ, C57BL/6JOlaHsd, DBA/2J
	g	106bp	129P3/J, C57BL/10
	j	130bp	JF1
	l	132bp	SJL/J
	p	128bp	PWB

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24