About   Help   FAQ
D16Mit55 Primer Detail
Primers
  • Name
    D16Mit55
  • Primer 1 Sequence
    TATGCGTTTAGTAATGATTTCCTACG
  • Primer 2 Sequence
    TGTAAGGACATATCTACCTTATCACCC
  • ID
    MGI:703511
  • Product Size
    135
  • Note
    MIT assay: MPC2196
Genes
D16Mit55 DNA segment, Chr 16, Massachusetts Institute of Technology 55
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D16Mit55 a 87bp SPRET/EiJ
b 113bp B6.Cg-Lepob/+, C57BL/6J
c 117bp C3H/HeJ, CAST/EiJ, DBA/2J, NON/ShiLt
d 119bp BALB/cJ
e 121bp A/J
f 143bp AKR/J, NOD/MrkTac
g 145bp LP/J
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
D16Mit55 d 104bp A/JOlaHsd, AKR/OlaHsd, BALB/cJ, C3H/HeJ, C57BL/6JOlaHsd, DBA/2J
g 106bp 129P3/J, C57BL/10
j 130bp JF1
l 132bp SJL/J
p 128bp PWB
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
06/12/2024
MGI 6.13
The Jackson Laboratory