D19Mit56 Primer Detail MGI Mouse MGI:703533

D19Mit56 Primer Detail

Name

D19Mit56
Primer 1 Sequence

CTGAATGTGTATGTGTGCAAGTATG
Primer 2 Sequence

ATTATGAATTCAAGACTAGCCTAGGA
ID

MGI:703533
Product Size

135
Other IDs

D19Mit56 (BROAD)
Note

MIT assay: MT213
Additional information: MIT STS Marker Data Files

D19Mit56

DNA segment, Chr 19, Massachusetts Institute of Technology 56

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D19Mit56	a	130bp	A/J, BALB/cJ, C3H/HeJ
	b	132bp	CAST/EiJ
	c	138bp	AKR/J, B6.Cg-Lep^ob/+, C57BL/6J, DBA/2J, LP/J, NOD/MrkTac

J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87

Gene	Allele	Fragments	Strains
D19Mit56	b	121bp	C57BL/6JOlaHsd
	c	113bp	A/JOlaHsd, BALB/cJ, C3H/HeJ
	d	123bp	129P3/J, AKR/OlaHsd, C57BL/10, DBA/2J, SJL/J
	j	131bp	JF1
	p	125bp	PWB

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/12/2024 MGI 6.24