D5Mit93 Primer Detail MGI Mouse MGI:703555

D5Mit93 Primer Detail

Name

D5Mit93
Primer 1 Sequence

TGCTCTTCCAGAAGACCCAA
Primer 2 Sequence

TGGACTACTGTATTTCACACTTGC
ID

MGI:703555
Product Size

193
Other IDs

D5Mit93 (BROAD)
Note

MIT assay: MPC843
Additional information: MIT STS Marker Data Files

D5Mit93

DNA segment, Chr 5, Massachusetts Institute of Technology 93

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D5Mit93	c	194bp	C3HeB/FeJLe
	D5Mit93	f	smaller	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D5Mit93	a	146bp	SPRET/EiJ
	b	170bp	DBA/2J, LP/J
	c	188bp	NON/ShiLt
	d	190bp	A/J, B6.Cg-Lep^ob/+, BALB/cJ, C57BL/6J
	e	192bp	AKR/J, NOD/MrkTac
	f	194bp	C3H/HeJ
	g	198bp	CAST/EiJ

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/12/2024 MGI 6.24