D5Mit99 Primer Detail MGI Mouse MGI:703561

D5Mit99 Primer Detail

Name

D5Mit99
Primer 1 Sequence

CAGAAAAGAGAAAACGGAGGG
Primer 2 Sequence

TTCCTGCTGCCTGAAGTTTT
ID

MGI:703561
Product Size

200
Other IDs

D5Mit99 (BROAD)
Note

MIT assay: MPC1630
Additional information: MIT STS Marker Data Files

D5Mit99

DNA segment, Chr 5, Massachusetts Institute of Technology 99

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D5Mit99	b	smaller	C57BL/6J
	D5Mit99	f	larger	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D5Mit99	a	98bp	C57BL/6J, NON/ShiLt
	b	198bp	B6.Cg-Lep^ob/+
	c	202bp	AKR/J, CAST/EiJ, SPRET/EiJ
	d	204bp	A/J, BALB/cJ, C3H/HeJ, DBA/2J, LP/J, NOD/MrkTac

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D5Mit99	c	199bp	CBA/CaOlaHsd
	D5Mit99	s	104bp	SWR/OlaHsd

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 06/12/2024 MGI 6.13