About   Help   FAQ
D6Mit289 Primer Detail
Primers
  • Name
    D6Mit289
  • Primer 1 Sequence
    TGGAGATCCACGGCATTG
  • Primer 2 Sequence
    CTAGATTGAAGAATTCCTGGACC
  • ID
    MGI:703584
  • Product Size
    135
  • Other IDs
    D6Mit289 (BROAD)
  • Note
    MIT assay: MTH330
    Additional information: MIT STS Marker Data Files
Genes
D6Mit289 DNA segment, Chr 6, Massachusetts Institute of Technology 289
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D6Mit289 a 116bp SPRET/EiJ
b 128bp NOD/MrkTac
c 134bp B6.Cg-Lepob/+, C57BL/6J, NON/ShiLt
d 138bp AKR/J, BALB/cJ, C3H/HeJ, DBA/2J, LP/J
e 140bp A/J
f 172bp CAST/EiJ
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
D6Mit289 b 136bp 129P3/J, C57BL/6JOlaHsd, C57BL/10
d 140bp AKR/OlaHsd, BALB/cJ, C3H/HeJ, DBA/2J, PWB
j 140bp JF1
w 142bp A/JOlaHsd, SJL/J
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/10/2024
MGI 6.24
The Jackson Laboratory