DXMit6 Primer Detail MGI Mouse MGI:703595

DXMit6 Primer Detail

Name

DXMit6
Primer 1 Sequence

ACCATTCAAATTGGCAAGGC
Primer 2 Sequence

GTGGCTCGAGTTGTTTGCAG
ID

MGI:703595
Product Size

207
Other IDs

DXMit6 (BROAD)
Note

MIT assay: D28
Additional information: MIT STS Marker Data Files
Synonyms

DXMit6-pA, DXMit6-pB

DXMit6

DNA segment, Chr X, Massachusetts Institute of Technology 6

J:4132 Angel TA, et al., Mamm Genome. 1993;4(3):171-6

Gene	Allele	Fragments	Strains
DXMit6	b	208bp	C57BL/6J-A^w-J/J
	c	204bp	M. m. castaneus
	h	208bp	C3H
	s	not given	M. spretus

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Endonuclease	Gene	Allele	Fragments	Strains
	DXMit6	a	204bp	CAST/EiJ, SPRET/EiJ
	DXMit6	b	208bp	A/J, AKR/J, B6.Cg-Lep^ob/+, BALB/cJ, C3H/HeJ, C57BL/6J, DBA/2J, LP/J

J:4132 Angel TA, et al., Genetic mapping of the X-linked dominant mutations striated (Str) and bare patches (Bpa) to a 600-kb region of the mouse X chromosome: implications for mapping human disorders in Xq28. Mamm Genome. 1993;4(3):171-6

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 06/12/2024 MGI 6.13