About   Help   FAQ
D12Mit158 Primer Detail
Primers
  • Name
    D12Mit158
  • Primer 1 Sequence
    CATTGGGCAATGGAATTTG
  • Primer 2 Sequence
    ATGAGAGAAAACCAGAAACAAAGG
  • ID
    MGI:703647
  • Product Size
    150
  • Other IDs
    D12Mit158 (BROAD)
  • Note
    MIT assay: MT2388
    Additional information: MIT STS Marker Data Files
Genes
D12Mit158 DNA segment, Chr 12, Massachusetts Institute of Technology 158
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D12Mit158 a 147bp 129X1/Sv
f 131, 147bp CD-1
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D12Mit158 a 131bp AKR/J, DBA/2J, NOD/MrkTac, NON/ShiLt
b 145bp SPRET/EiJ
c 147bp B6.Cg-Lepob/+, BALB/cJ, C57BL/6J, LP/J
d 152bp C3H/HeJ
e 160bp A/J
f 166bp CAST/EiJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D12Mit158 c 135bp CBA/CaOlaHsd
s 145bp SWR/OlaHsd
J:156851 Golas A, MGI Direct Data Submission. 2010;
Endonuclease Gene Allele Fragments Strains
D12Mit158 b lower C57BL/6J
s upper 129/Sv
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;
J:156851 Golas A, Microsatellite differences on Chromosome 3, 6, 11 and 12 in C57BL/6J and 129/Sv strains and Mapping in CBXE RI line. MGI Direct Data Submission. 2010;
Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support. 		last database update
11/12/2024
MGI 6.24 		The Jackson Laboratory