D3Mit46 Primer Detail MGI Mouse MGI:703720

D3Mit46 Primer Detail

Name

D3Mit46
Primer 1 Sequence

ATCCCCCACCCAACTCTAAC
Primer 2 Sequence

TTCCCCAGGGAAATCTCTCT
ID

MGI:703720
Product Size

162
Other IDs

D3Mit46 (BROAD)
Note

MIT assay: D534
Additional information: MIT STS Marker Data Files

D3Mit46

DNA segment, Chr 3, Massachusetts Institute of Technology 46

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Gene	Allele	Fragments	Strains
D3Mit46	b	not given	C57BL/6J
	c	178bp	C3HeB/FeJLe
	f	smallest	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D3Mit46	a	152bp	AKR/J
	b	158bp	NON/ShiLt
	c	160bp	DBA/2J
	d	162bp	LP/J, NOD/MrkTac
	e	164bp	BALB/cJ
	f	166bp	B6.Cg-Lep^ob/+, C57BL/6J
	g	172bp	A/J, C3H/HeJ
	h	190bp	CAST/EiJ
	i	194bp	SPRET/EiJ

J:55077 Le Voyer TE, et al., Mamm Genome. 1999 Jun;10(6):542-3

Gene	Allele	Fragments	Strains
D3Mit46	c	not given	C58/J
	f	not given	FVB/NJ
	i	smaller	I/LnJ

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D3Mit46	c	195bp	CBA/CaOlaHsd
	D3Mit46	s	161bp	SWR/OlaHsd

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:55077 Le Voyer TE, et al., Microsatellite DNA variants among the FVB/NJ, C58/J, and I/LnJ mouse strains. Mamm Genome. 1999 Jun;10(6):542-3

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24