About   Help   FAQ
D3Mit9 Primer Detail
Primers
  • Name
    D3Mit9
  • Primer 1 Sequence
    AACTTCATTTGCTTGGAAACTACC
  • Primer 2 Sequence
    TGTTTTATATTGCCCTGTATGTGC
  • ID
    MGI:703744
  • Product Size
    233
  • Note
    MIT assay: A85
Genes
D3Mit9 DNA segment, Chr 3, Massachusetts Institute of Technology 9
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D3Mit9 a 214bp SPRET/EiJ
b 218bp A/J
c 220bp C3H/HeJ, LP/J
d 226bp C57BL/6J, NON/ShiLt
e 228bp B6.Cg-Lepob/+
f 230bp NOD/MrkTac
g 236bp CAST/EiJ
h 240bp AKR/J, BALB/cJ, DBA/2J
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D3Mit9 l smaller LG/J
s larger SM/J
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/10/2024
MGI 6.24
The Jackson Laboratory