D3Mit1 Primer Detail MGI Mouse MGI:703751

D3Mit1 Primer Detail

Name

D3Mit1
Primer 1 Sequence

TGTGCACAGGGGTACATACA
Primer 2 Sequence

TCATTTTCTTCCTCCCCCTC
ID

MGI:703751
Product Size

143
Note

MIT assay: M28

D3Mit1

DNA segment, Chr 3, Massachusetts Institute of Technology 1

J:42684 Koide T, et al., Mamm Genome. 1998 Jan;9(1):15-9

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D3Mit1	a	largest	JF1, MSM/Ms
Not Specified	D3Mit1	b	smaller	C57BL/6, DBA/2

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D3Mit1	a	118bp	CAST/EiJ
	b	120bp	A/J, AKR/J, C3H/HeJ, C57BL/6J, DBA/2J, NON/ShiLt
	c	123bp	BALB/cJ, NOD/MrkTac
	d	132bp	LP/J
	e	134bp	B6.Cg-Lep^ob/+

J:42684 Koide T, et al., A new inbred strain JF1 established from Japanese fancy mouse carrying the classic piebald allele [published erratum appears in Mamm Genome 1998 Apr;9(4):344]. Mamm Genome. 1998 Jan;9(1):15-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24