D14Mit268 Primer Detail MGI Mouse MGI:703764

D14Mit268 Primer Detail

Name

D14Mit268
Primer 1 Sequence

CCTTCACATGGACATACATA
Primer 2 Sequence

AAAGACAGACATTGAGAAAGAC
ID

MGI:703764
Product Size

295
Other IDs

D14Mit268 (BROAD)
Note

MIT assay: MTH2307
Additional information: MIT STS Marker Data Files

DNA Segment, Chr 14, Massachusetts Institute of Technology 268

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D14Mit268	a	305bp	B6.Cg-Lep^ob/+, C57BL/6J
	b	306bp	CAST/EiJ
	c	315bp	SPRET/EiJ
	d	325bp	DBA/2J, NOD/MrkTac, NON/ShiLt
	e	350bp	AKR/J, LP/J

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Gene	Allele	Fragments	Strains
D14Mit268	a	350bp	129/SvW, A.CA/W, AKR/W, BALB/cW, BN/aW, C3H/W, CBA/W
	b	325bp	DBA/2W
	c	305bp	C57BL/6W, C57BL/10W

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/12/2024 MGI 6.24