About   Help   FAQ
D14Mit268 Primer Detail
Primers
  • Name
    D14Mit268
  • Primer 1 Sequence
    CCTTCACATGGACATACATA
  • Primer 2 Sequence
    AAAGACAGACATTGAGAAAGAC
  • ID
    MGI:703764
  • Product Size
    295
  • Other IDs
    D14Mit268 (BROAD)
  • Note
    MIT assay: MTH2307
    Additional information: MIT STS Marker Data Files
Genes
D14Mit268 DNA Segment, Chr 14, Massachusetts Institute of Technology 268
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D14Mit268 a 305bp B6.Cg-Lepob/+, C57BL/6J
b 306bp CAST/EiJ
c 315bp SPRET/EiJ
d 325bp DBA/2J, NOD/MrkTac, NON/ShiLt
e 350bp AKR/J, LP/J
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D14Mit268 a 350bp 129/SvW, A.CA/W, AKR/W, BALB/cW, BN/aW, C3H/W, CBA/W
b 325bp DBA/2W
c 305bp C57BL/6W, C57BL/10W
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
06/12/2024
MGI 6.13
The Jackson Laboratory