D7Mit19 Primer Detail MGI Mouse MGI:703785

D7Mit19 Primer Detail

Name

D7Mit19
Primer 1 Sequence

GCTGCAGCTCTCTCTGGG
Primer 2 Sequence

GATGGCTCTGATACAGCAAGC
ID

MGI:703785
Product Size

133
Other IDs

D7Mit19 (BROAD)
Note

MIT assay: d108
Additional information: MIT STS Marker Data Files

D7Mit19

DNA segment, Chr 7, Massachusetts Institute of Technology 19

J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D7Mit19	m	142bp	MOLF/EiJ
Not Specified	D7Mit19	s	134bp	129/Sv

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D7Mit19	a	126bp	SPRET/EiJ
	b	130bp	CAST/EiJ
	c	134bp	A/J, AKR/J, B6.Cg-Lep^ob/+, BALB/cJ, C3H/HeJ, C57BL/6J, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt

J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24