D1Mit403 Primer Detail MGI Mouse MGI:703799

D1Mit403 Primer Detail

Name

D1Mit403
Primer 1 Sequence

TATTGAGGGTGTGTTTTTATTTCTC
Primer 2 Sequence

CTCCACGGGTCCCTGTATTC
ID

MGI:703799
Product Size

122
Other IDs

D1Mit403 (BROAD)
Note

MIT assay: MJ4758
Additional information: MIT STS Marker Data Files

D1Mit403

DNA segment, Chr 1, Massachusetts Institute of Technology 403

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D1Mit403	c	147bp	C3HeB/FeJLe
Not Specified	D1Mit403	f	smaller	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D1Mit403	a	125bp	B6.Cg-Lep^ob/+, C57BL/6J
	b	127bp	AKR/J, DBA/2J
	c	129bp	NON/ShiLt
	d	131bp	A/J
	e	147bp	BALB/cJ, C3H/HeJ, LP/J, NOD/MrkTac
	f	157bp	SPRET/EiJ
	g	195bp	CAST/EiJ

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D1Mit403	c	233bp	CBA/CaOlaHsd
	D1Mit403	s	235bp	SWR/OlaHsd

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/19/2024 MGI 6.24