D19Mit110 Primer Detail MGI Mouse MGI:703813

D19Mit110 Primer Detail

Name

D19Mit110
Primer 1 Sequence

TGTAATCAATGTATGTTAAACTTAGGC
Primer 2 Sequence

TGAATTGGGTCTTTCCTTGG
ID

MGI:703813
Product Size

171
Other IDs

D19Mit110 (BROAD)
Note

MIT assay: MTH1581
Additional information: MIT STS Marker Data Files

DNA Segment, Chr 19, Massachusetts Institute of Technology 110

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D19Mit110	a	173bp	129P2/Ola, 129P3/J, 129T1/Sv-Dnd1^Ter, 129X1/Sv
		b	177bp	129X1/SvJ
		c	173, 175bp	CD-1

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D19Mit110	a	163bp	C3H/HeJ, DBA/2J, LP/J
	b	171bp	AKR/J, B6.Cg-Lep^ob/+, BALB/cJ, C57BL/6J, NOD/MrkTac, NON/ShiLt
	c	175bp	A/J
	d	179bp	SPRET/EiJ
	e	195bp	CAST/EiJ

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 06/12/2024 MGI 6.13