D10Mit40 Primer Detail MGI Mouse MGI:703816

D10Mit40 Primer Detail

Name

D10Mit40
Primer 1 Sequence

GGCTTTGGGGATAGCATTG
Primer 2 Sequence

AGGTCAACATGCTGTCAAACA
ID

MGI:703816
Product Size

149
Other IDs

D10Mit40 (BROAD)
Note

MIT assay: B184
Additional information: MIT STS Marker Data Files

D10Mit40

DNA segment, Chr 10, Massachusetts Institute of Technology 40

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D10Mit40	a	140bp	129X1/Sv
Not Specified	D10Mit40	f	144bp	CD-1

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D10Mit40	a	140bp	BALB/cJ, LP/J, NON/ShiLt
	b	146bp	A/J, AKR/J, B6.Cg-Lep^ob/+, C3H/HeJ, C57BL/6J, NOD/MrkTac
	c	148bp	DBA/2J
	d	162bp	CAST/EiJ

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/05/2024 MGI 6.24